View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16967_low_34 (Length: 285)
Name: NF16967_low_34
Description: NF16967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16967_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 13 - 271
Target Start/End: Complemental strand, 22956446 - 22956188
Alignment:
| Q |
13 |
aatatggaaaggattcgaaattgtttttgaatcaagtatgaagtcgacattatcaacgtgagaatgatgacaacgagcaactatcttatggacatttctc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22956446 |
aatatggaaaggattcgaaattgtttttgaatcaagcatgaagtcgacattatcaacatgagaatgatgacaacgagcaactatcttaaggacatttctc |
22956347 |
T |
|
| Q |
113 |
tattaaattatgaactcgctctaccacttgtgtgcatagctcattaacatcttgccatgatttaaggttcatgtgcttccaaatactcaaaaacagggag |
212 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22956346 |
tattaaatgatgaactcgctctaccacttgtgtgcatagctcattaacatcttgccatgatttaaggttcatgtgcttccaaatactcaaaaacagggag |
22956247 |
T |
|
| Q |
213 |
agattcaactaacacaacgtgtagggaattgcacaccattaccaaaaatagcacaatct |
271 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22956246 |
agattcagctaacacaacttgtagggaattgcacaccattaccgaaaatagcacaatct |
22956188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 134 - 205
Target Start/End: Original strand, 6979788 - 6979859
Alignment:
| Q |
134 |
taccacttgtgtgcatagctcattaacatcttgccatgatttaaggttcatgtgcttccaaatactcaaaaa |
205 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| |||| ||||||| ||||||| ||||||||||||| |||| |
|
|
| T |
6979788 |
taccacttgtgcgcatagctcactaacatcttcccataatttaagattcatgttcttccaaatactccaaaa |
6979859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 131 - 178
Target Start/End: Complemental strand, 33168922 - 33168875
Alignment:
| Q |
131 |
ctctaccacttgtgtgcatagctcattaacatcttgccatgatttaag |
178 |
Q |
| |
|
|||||||||||| | |||||||||||||||||| ||||||| |||||| |
|
|
| T |
33168922 |
ctctaccacttgcgcgcatagctcattaacatcgtgccatggtttaag |
33168875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University