View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16967_low_43 (Length: 230)
Name: NF16967_low_43
Description: NF16967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16967_low_43 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 2391021 - 2390788
Alignment:
| Q |
1 |
actctttgtatctcttgatttttgcttagtaaatagataaacagttacaatctttatttctagatcacata----tagttggaagaaattggcctttcat |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2391021 |
actctttgtatctcttgatttttgcttagtaaatagataaacagttacaatctttatttctagatcacatacatatagttggaagaaattggcctttcat |
2390922 |
T |
|
| Q |
97 |
tttcaatcttcacgaaaaaactttgtttgtcacaagaaagttgtcatgggaagcttgtgatttttcatctgctgaaccaattctgtcacatcaaagttgg |
196 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2390921 |
tttcaatcttcacgaaaaaactttgtctgtcacaagaaagttgtcatgggaagcttgtgatttttcatctgctgaaccaattctgtcacatcaaagttgg |
2390822 |
T |
|
| Q |
197 |
ttttcttaacttctgataaatcagtttttggtgt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2390821 |
ttttcttaacttctgataaatcagtttttggtgt |
2390788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University