View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16968_low_1 (Length: 369)
Name: NF16968_low_1
Description: NF16968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16968_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 74 - 355
Target Start/End: Complemental strand, 45616122 - 45615837
Alignment:
| Q |
74 |
gtgcctactaattactcttattgtttagtctatgatttaa-tattttatttttgactgatgtcttaaccacccattttct-taatgatttcttttccaaa |
171 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||| |||||||| ||||||||| ||||||||||||||| ||| |
|
|
| T |
45616122 |
gtgcctactaattactcttaatgtttagtctatgatttaagtatcttatttttgactgatgacttaaccaaccattttctctaatgatttcttttcaaaa |
45616023 |
T |
 |
| Q |
172 |
attctatttctaaaagggcaagctggtatcctactttgaacctagctatattcttagatggaccctacttatgatttataatctt--ctattagtccaaa |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
45616022 |
attctatttctaaaagggcaagctggtatcctactttgaacctagctatattcttagatggaccctacttatggcttataatctgtgctattagtccaaa |
45615923 |
T |
 |
| Q |
270 |
ttccagagcggcataaataaagagtagccacgggttcttttatatcaccataaataattatggcatttgtgaagacattgtatatg |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45615922 |
ttccagagcggcataaataaagagtagccacaggttcttttatatgaccataaataattatggcatttgtgaagacattgtatatg |
45615837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University