View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16969_low_12 (Length: 246)
Name: NF16969_low_12
Description: NF16969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16969_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 52784268 - 52784048
Alignment:
| Q |
18 |
tgtgtggcaagtgagaatttatttggttatatgctgacatttttatgcaccttttgtcattttttgtttgaaaatgcccgttgttgcgaaaagcatattc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
52784268 |
tgtgtggcaagtgagaatttatttggttatatgctgacatttttatgaaccttttgtcattttttgtttgaaaatgcccgttgtcgcgaaaagcatcttc |
52784169 |
T |
|
| Q |
118 |
acaaaatgatg----atgttaaatgtgattggttcttattggatatcacttacgccttatgtgatttccaataaggaccgaattacacacagcttctccc |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52784168 |
acaaaatgatgatgcatgttaaatgtgattggttcttatcggatatcacttacgccttatgtgatctccaataaggaccgaattacacacagcttctccc |
52784069 |
T |
|
| Q |
214 |
tttaataatataacacatatt |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
52784068 |
tttaataatataacacatatt |
52784048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University