View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16969_low_9 (Length: 272)
Name: NF16969_low_9
Description: NF16969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16969_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 3 - 266
Target Start/End: Complemental strand, 25273484 - 25273221
Alignment:
| Q |
3 |
caaaggtggtgggatggtggaagtgtttgtcagcggttagtttaaagttaaaacgacgacggtgtggagagcgaggtcgccagagtggatagcaagagag |
102 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25273484 |
caaaggtgatgggatggtggaagtgtttgtcagcggtaagtttaaagttaaaacgacgatggcgtggagagcgaggtcgccagagtggatagcaagagag |
25273385 |
T |
|
| Q |
103 |
aatgatttgctaatggtggaagttgcgatgttggatcagtgtgtggttgcagtgatgctgtagctagctcctacttcttctcctatcttannnnnnnatg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25273384 |
aatgatttgctaatggtggaagttgcgatgttggatcagtgtgtggttgcagtgatgctgtagctagctcctacttcttctcctatcttatttttttatg |
25273285 |
T |
|
| Q |
203 |
atttcctttctctctcaaacaaatatttcatatggcctttgtttttgttttgatgatgatgatg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25273284 |
atttcctttctctctcaaacaaatatttcatatggcatttgtttttgttttgatgatgatgatg |
25273221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University