View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696_high_13 (Length: 350)
Name: NF1696_high_13
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 336
Target Start/End: Complemental strand, 38400245 - 38399910
Alignment:
| Q |
1 |
gtcaccaccactgatcctggatcagcctgatatctgcataagattaatcaaaattttatgtcaaaaatatgcatctaaaatcttaataatatgatttatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| || ||||||||||| |||||||||||| |
|
|
| T |
38400245 |
gtcaccaccactgatcctggatcagcctgatatctgcataagcttaaacaaaattttatgtcaaaaatatacaattaaaatcttaaacatatgatttatt |
38400146 |
T |
|
| Q |
101 |
ttttaatgaagattactaaacaccgacccaatttgtaacgttggttcacactcaataggttgaaatacatcatgatcaccctggttttgacctggatgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38400145 |
ttttaatgaagattactaaacaccgacccaatttgtaacgttggttcacactcaataggttgaaatacatcatgatcaccctggttttgacctggatgat |
38400046 |
T |
|
| Q |
201 |
ggcgtccatatcccatatcttcagcactcagattcagttggagtgaatttatttgatacccttccatctgaaacaaaaacatcacaagtcactatcatta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38400045 |
ggcgtccatatcccatatcttcagcactcagattcagttggagtgaatttatttgatacccttccatctgaaacaaaaacatcacaagtcactatcatta |
38399946 |
T |
|
| Q |
301 |
accaacccctcaaatttcaataccatatgtaggaat |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38399945 |
accaacccctcaaatttcaataccatatgtaggaat |
38399910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University