View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696_high_18 (Length: 310)
Name: NF1696_high_18
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696_high_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 13 - 303
Target Start/End: Complemental strand, 6125481 - 6125191
Alignment:
| Q |
13 |
aatgggaacaactggcaaggggaccggcaaggggactggcaaaggtagaacattcttatgttaggaatgaaccagtaatgattggcagagaagaggagaa |
112 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6125481 |
aatgggaccaactggcaagggaaccggcaaggggactggcaatggtagaacattcttatgttaggaatgaaccagtaatgattggcagagaagaggagaa |
6125382 |
T |
|
| Q |
113 |
acaggcgataataagcctgttaatggaaccaactgatagcctgttaatggaaccatctgaggagaaacattctgatgattctctgattggtattgttggt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6125381 |
acaggcgataataagcctgttaatggaaccaactgatagactgttaatggaaccatctgaggagaaacattctgatgattctctgattggtattgttggt |
6125282 |
T |
|
| Q |
213 |
atgggtggtataggaaagacagttcttgctatgatggtatacaaagatgcacaagtccgagatttctttgatatccgcatgtgggtctgtg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6125281 |
atgggtggtataggaaagacagttcttgctatgatggtatacaaagatgcacaagtccgagatttctttgatatccgcatgtgggtgtgtg |
6125191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 198 - 299
Target Start/End: Original strand, 6114208 - 6114309
Alignment:
| Q |
198 |
attggtattgttggtatgggtggtataggaaagacagttcttgctatgatggtatacaaagatgcacaagtccgagatttctttgatatccgcatgtggg |
297 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||| | |||| |||| ||||||| || ||||||| || ||||||||||||| |||| |||| |
|
|
| T |
6114208 |
attgctattgttggtatgggtggtataggcaagacaactgttgcccagatgatatacaatgacagacaagtcaaaggtttctttgatatctgcatatggg |
6114307 |
T |
|
| Q |
298 |
tc |
299 |
Q |
| |
|
|| |
|
|
| T |
6114308 |
tc |
6114309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University