View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696_high_27 (Length: 272)
Name: NF1696_high_27
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 19 - 265
Target Start/End: Complemental strand, 47262205 - 47261959
Alignment:
| Q |
19 |
aataccactgattttaacaactttgctattggtttggttgctagaaatagctttggttactccggaccaagcataaggttagttggacttggacactgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47262205 |
aataccactgattttaacaactttgctattggtttggttgctagaaatagctttggttactccggaccaagcataaggttagttggacttggacactgtt |
47262106 |
T |
|
| Q |
119 |
ttcttcaacttttgtcaagttttgatgatattaatctttatgtggttggtacttggtagatatatagaatatagatcattatcatttagttgtggttata |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47262105 |
ttcttcaacttttgtcaagttttgatgatattaatctttatttggttggtacttggtagatatatagaatatagatcattatcatttagttgtggttata |
47262006 |
T |
|
| Q |
219 |
ctgtatctgtaaaatttcctaagtttttgttgtcctatcctatgcta |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47262005 |
ctgtatctgtaaaatttcctaagtttttgttgtcctatcctatgcta |
47261959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University