View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696_high_30 (Length: 266)
Name: NF1696_high_30
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696_high_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 249
Target Start/End: Original strand, 24637685 - 24637924
Alignment:
| Q |
9 |
gattattcttcaagattaagggaagaggatgaggagttcaaaagagaccaaacaaataaatcgtaatgtcccatattatattggtaaaaagattgacaaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24637685 |
gattattcttcaagattaagggaagaggatgaggagttcaaaagagaccaaacaaataaatcgtaatgtcccatattatattggtaaaaagattgacaaa |
24637784 |
T |
|
| Q |
109 |
aaggttagcctctatatagatagatgtgcaagatacggagctcccaatcacgagataaaagagtcagctggttggtgaagcagcgttagtattgaaatgc |
208 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24637785 |
aaagttagcctctatatagatagatgtgcaagatacggagctcccaatcacgatat-aaagagtcagttggttggtgaagcagcgttagtattgaaatgc |
24637883 |
T |
|
| Q |
209 |
agggttggaagtctcccttttttatacctggggctgcctat |
249 |
Q |
| |
|
| |||||||||||||||||| | || ||||||||||||| |
|
|
| T |
24637884 |
aatgttggaagtctcccttttgtgtatttggggctgcctat |
24637924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University