View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696_high_49 (Length: 218)
Name: NF1696_high_49
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696_high_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 41375869 - 41376045
Alignment:
| Q |
18 |
atgaagaggtggcaaacatttgtaagagaaacggattgatttggatcttacaacttattgttgatatttcaaagttctaacgagnnnnnnnntaataaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41375869 |
atgaagaggtggcaaacatttgtaagagaaacggattgatttggatcttacaacttattgttgatatttcaaagttctaacgagaaaaaaaataataaga |
41375968 |
T |
 |
| Q |
118 |
agggagcggtaataacagccacaagaggagcttaatgcatgaaggagatattgattgaattgaaatcaatggaaaag |
194 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41375969 |
agggaggggtaataacagccacaagaggagcttaatgcatgaaggagatattgattgaattgaaatcaatggaaaag |
41376045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University