View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696_low_12 (Length: 373)
Name: NF1696_low_12
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 17 - 363
Target Start/End: Complemental strand, 44080251 - 44079907
Alignment:
| Q |
17 |
acgttattattaaattattgaggatggctttgtaattgtaattttttatgaacttatccgagttaatagattaatctattgtgaatgataaactttaaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
44080251 |
acgttattattaaattattgaggatggctttgtaattgtaattttttgtgaacttatccgagttgatagattaatctattgtgaatgataaacttaaaaa |
44080152 |
T |
|
| Q |
117 |
tgacggtgttagaaagtagcaatttggggaaaaaagatggcatggcaatggcacccaaaatggggtgcgccaattgagaccaagacaggggaaaaggatc |
216 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44080151 |
tgacggtgatagaaagtagcaatttggggaaaaaagatggcatggcaatggcacccaaaatggggtgcgccaattgagaccaagacaggggaaaaggatc |
44080052 |
T |
|
| Q |
217 |
aatnnnnnnnnnnnngtgaaactgttatccaacaaggatgaacgtgggtaacagtgattggaaggatggagaaactgagtaatggagataggggaccttg |
316 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44080051 |
aat--aaaaaaaaaagtgaaactgttatccaacaaggatgaacgtgggtaacagtgattggaaggatggagaaactgaggaatggagataggggaccttg |
44079954 |
T |
|
| Q |
317 |
gcagctgagttgatgtgatgtgcatctataaggtgtaacattctgtg |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44079953 |
gcagctgagttgatgtgatgtgcatctataaggtgtaacattctgtg |
44079907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University