View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696_low_45 (Length: 236)
Name: NF1696_low_45
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 54237143 - 54236914
Alignment:
| Q |
1 |
taactaagctatacttacacgaccacttgtgcattttttaatctacaatatatttattaatgtcatttctttttatcaatataa----------cattta |
90 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54237143 |
taactaagctatacttacactaccacttgtgcattttttaatctacaatatatttattaatgtcatttctttttatcaatataatataatataacattta |
54237044 |
T |
 |
| Q |
91 |
ttaaattagaactccctctattgtcttctcactcaatgatcacttatcacccgaaaccagagatctcagctccaacgaggattagataactagataaatc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
54237043 |
ttaaattagaactccctctattgtcttctcactcaatgatcatttatcacctgaaaccagagatctcaactccaacgaggattagataactagataaatc |
54236944 |
T |
 |
| Q |
191 |
ttttaatttattggagttacgcctttgctt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
54236943 |
ttttaatttattggagttacgcctttgctt |
54236914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University