View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696_low_52 (Length: 223)
Name: NF1696_low_52
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696_low_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 106 - 205
Target Start/End: Original strand, 2813623 - 2813722
Alignment:
| Q |
106 |
catagtagtcttacatctgcaaaacgttttattattttgcagtttgtaataacaggaacataatataccaatgattattttaaatttcaaatcatatatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
2813623 |
catagtagtcttacatctgcaaaacgttttattattttgcagtttgtaataacaggaacataatatatccatgattattttaaatttcaaatcatatatt |
2813722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 15 - 67
Target Start/End: Original strand, 2813497 - 2813549
Alignment:
| Q |
15 |
cataggggaagatatgcagcaatgccaatggagacagatacttattcatccga |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2813497 |
cataggggaagatatgcagcaatgccaatggagacagatacttattcatccga |
2813549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University