View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696_low_53 (Length: 223)
Name: NF1696_low_53
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 123 - 210
Target Start/End: Complemental strand, 6454032 - 6453945
Alignment:
| Q |
123 |
ggggatggtggtttgagcgaaaagttagtgaaaaagggtagtgtagtactagttatttatggaagctgaggcctgagataatattagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6454032 |
ggggatggtggtttgagcgaaaagttagtgaaaaagggaagtatagtactagttatttatggaagctgaggcctgatataatattagt |
6453945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 53
Target Start/End: Complemental strand, 6454143 - 6454102
Alignment:
| Q |
13 |
gagatgaattaatttttccagagac-tactagtaacttagtc |
53 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6454143 |
gagatgaattaatttttccagagacttactagtaacttagtc |
6454102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University