View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696_low_58 (Length: 212)
Name: NF1696_low_58
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696_low_58 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 114 - 197
Target Start/End: Complemental strand, 45642159 - 45642076
Alignment:
| Q |
114 |
gccataccaatctatgacccaagtatacaatccagaatgcaaattttgtttctaagttctctacagctttccaaatatatgaag |
197 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45642159 |
gccataccaatctatgagccaagtatacaatccagaatgcaaattttgtttctaagttctctacagctttccaaatatatgaag |
45642076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 45642272 - 45642222
Alignment:
| Q |
1 |
gaatactgattgcatagttattatcattggaaccctttaatgtcatcagtc |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45642272 |
gaatactgattgcatagttattatcattggaaccctttaatgtcatcagtc |
45642222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University