View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696_low_8 (Length: 409)
Name: NF1696_low_8
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 301
Target Start/End: Complemental strand, 35424019 - 35423732
Alignment:
| Q |
11 |
cagagatatataccgtcttcaacattttgtattccaaaatacttgtttggaggtttgctacataaatggaactttttaataattgtcagatatttgtcaa |
110 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
35424019 |
cagagatatatactgtcttcaacattttgtattccaaaatacttgtttggaggtttgctacataaatggagcattttaataattgtcagatatttgtcaa |
35423920 |
T |
 |
| Q |
111 |
aataattataataattgcgagttcagactagacaagacaagtgtgggtggatcatgaagtattgaaaattttcactaacgacttatttaaaattttgttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
35423919 |
aataattataataattgcgagttcagactaga-----caagtgtgggtggatcatgaggtattgaaaaatttcactaacgacttatttaaaattttgtcg |
35423825 |
T |
 |
| Q |
211 |
ggagccggtcctag--nnnnnnnnagccgagagaaatttcattctctctctaatttcttatcttcttcattcacgatagatgactgattttag |
301 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35423824 |
ggagccggtcctagttttttttttagccgagagaaatttcattctctctctaatttcttatcttcttcattcacgatagatgactgattttag |
35423732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 325 - 394
Target Start/End: Complemental strand, 35423582 - 35423513
Alignment:
| Q |
325 |
tgcgatatttattttgtttgaattggcatatcaacttcaattcattacataatcaaccaataataacttg |
394 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
35423582 |
tgcgatgtttattttgttcgaattggcatatcaacttcaactcattatataatcaaccaataataacttg |
35423513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University