View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16970_high_7 (Length: 252)
Name: NF16970_high_7
Description: NF16970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16970_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 13 - 236
Target Start/End: Original strand, 53174843 - 53175066
Alignment:
| Q |
13 |
cagaacctgtggtggatagttcaaaaacaaagtaaagtccattgtcaatacaacatcctagaagagataaaacattggaatgacgaacatgaccaattgt |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53174843 |
cagaaccagtggtggatagttcaaaaacaaagtaaagtccattgtcaatacaacatcctagaagagataaaacattggaatgacgaacatgaccaattgt |
53174942 |
T |
 |
| Q |
113 |
tccaatctctgtcaaaaactctttctcttttctttcatcctttgaagctcttgttaatctcttcacagcaatttcttcaccatttttcaatgttcccttg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53174943 |
tccaatctctgtcaaaaactctttctcttttctttcatcctttgaagctcttgttaatctcttcacagcaatttcttcaccatttttcaatgttcccttg |
53175042 |
T |
 |
| Q |
213 |
taaacctcagcataaccacctttt |
236 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
53175043 |
taaacctcagcataaccacctttt |
53175066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University