View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16970_low_3 (Length: 434)
Name: NF16970_low_3
Description: NF16970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16970_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 13 - 299
Target Start/End: Complemental strand, 48451759 - 48451473
Alignment:
| Q |
13 |
gagatgaatccttgtgagcagttctattttcgttgatagcagctactaacttgtccgcagggttatcagtaattttgactgcaaagttttcataatgtca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451759 |
gagatgaatccttgtgagcagttctattttcgttgatagcagctactaacttgtccgcagggttatcagtaattttgactgcaaagttttcataatgtca |
48451660 |
T |
 |
| Q |
113 |
cacaaatgttaatttagagaacacacaagtgggtaacagtgaatgcaataaaagaaatttaatcacatagtaaggaaataaatataactatgaggtaggg |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451659 |
cacaaatgttaatgtagagaacacacaagtgggtaacagtgaatgcaataaaagaaatttaatcacatagtaaggaaataaatataactatgaggtaggg |
48451560 |
T |
 |
| Q |
213 |
attcagaatgatagataagttgatatttgagaattttcactttttcagtaagccaaaagtaggctgtttattgtgacgaaagtagcc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451559 |
attcagaatgatagataagttgatatttgagaattttcactttttcagtaagccaaaagtaggctgtttattgtgacgaaagtagcc |
48451473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 369 - 415
Target Start/End: Complemental strand, 48451404 - 48451358
Alignment:
| Q |
369 |
cacataaactgagtttttgcaaactgtgtttgaaatacagtcagtac |
415 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451404 |
cacataaactgagtttttgcaaactgtgtttgaaatacagtcagtac |
48451358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University