View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16971_high_4 (Length: 265)
Name: NF16971_high_4
Description: NF16971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16971_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 12 - 248
Target Start/End: Complemental strand, 44006310 - 44006078
Alignment:
| Q |
12 |
atcatcatgttactttagacaggacaattgatcactttcataataacatttggttgtagnnnnnnncaaagaaaaacatccgattactatagacannnnn |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44006310 |
atcatcatgttactttagacaggacaattgatcactttcataataacatttggttgtagtttttttcaaagaaaaacatccgattactatagacatattt |
44006211 |
T |
 |
| Q |
112 |
nnnnnnnngaattagcaaaatttattaatcacaggaagctttgagcacaagatgagcaagagcacgcaaaagggaatacaaaagagagaaacaacaagaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44006210 |
ttttttt-gaattagcaaaatttattaatcacaggaagctttgagcacaagatgagcaagagcacgcaaaagggaatacaaaagagagaa---acaagaa |
44006115 |
T |
 |
| Q |
212 |
aaataacagcagcagctgagctaacacagtaataatt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44006114 |
aaataacagcagcagctgagctaacacagtaataatt |
44006078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University