View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16973_high_5 (Length: 425)
Name: NF16973_high_5
Description: NF16973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16973_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 285
Target Start/End: Original strand, 54147108 - 54147373
Alignment:
| Q |
18 |
aatccttttgttcgtccatgactattcaatatggtttgtttcttctttttctcatttaatttgctggtcaaaattagttcctattggttgattagcatgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54147108 |
aatccttttgttcgtccatgactattcaatatggtttgtttcttctttttctcatttaatttgctggtcaaaattagttcctattggttgattagcatgt |
54147207 |
T |
|
| Q |
118 |
tgcttttttgttttgattgggagaccgataaatttctaatggtgaaggtagtgtacctaagcataaattggttttttggtgcttgggagttagtaggctt |
217 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54147208 |
tgctttt--gttttgattgggagaccgataaatttataatggtgaaggtagtgtacctaagcataaattggttttttagtgcttgggagttagtaggctt |
54147305 |
T |
|
| Q |
218 |
cattgttgtgataacatggcattggtaactagtcttctcaatgtctgcaaaattgtgttggtctatga |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54147306 |
cattgttgtgataacatggcattggtaactagtcttctcaatgtctacaaaattgtgttggtctatga |
54147373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 203 - 273
Target Start/End: Complemental strand, 24487524 - 24487454
Alignment:
| Q |
203 |
ggagttagtaggcttcattgttgtgataacatggcattggtaactagtcttctcaatgtctgcaaaattgt |
273 |
Q |
| |
|
|||||||||||||||| |||||||| |||||| ||| ||| ||||||||||| |||||| |||||||| |
|
|
| T |
24487524 |
ggagttagtaggcttctttgttgtggcaacatgatatttgtatctagtcttctcgttgtctgtaaaattgt |
24487454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 123 - 167
Target Start/End: Complemental strand, 24487600 - 24487555
Alignment:
| Q |
123 |
ttttgttttgattgggagaccgata-aatttctaatggtgaaggta |
167 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||| ||||||||||| |
|
|
| T |
24487600 |
ttttgttttgattgggagaccgatagaatatctagtggtgaaggta |
24487555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University