View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16973_low_15 (Length: 223)
Name: NF16973_low_15
Description: NF16973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16973_low_15 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 21 - 223
Target Start/End: Complemental strand, 9003629 - 9003425
Alignment:
| Q |
21 |
atcatattcgacacctaagatttcgttgcaataaacaa--caatttagccaatttattttctatataaatatatacataagtatcattcaacaaagtgct |
118 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
9003629 |
atcatattcgacacctaaaatttcgtcgcaataaacaaaacaatttaaccaatttattttctatataaatatatacataagtatcattcagcgaagtgct |
9003530 |
T |
|
| Q |
119 |
tgattaagttgtttatccagacgtatatttgtatcaaatacgtaccagattggtgtcattggtggtgttatcgtcgagtctatactcatgcatgatccaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9003529 |
tgattaagttgtttatccagacgtatatttgtatcaaatacttaccagattggtgtcattggtggtgttatcgtcgagtctatactcatgcatgatccaa |
9003430 |
T |
|
| Q |
219 |
tcaga |
223 |
Q |
| |
|
||||| |
|
|
| T |
9003429 |
tcaga |
9003425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 140
Target Start/End: Original strand, 17775541 - 17775569
Alignment:
| Q |
112 |
aagtgcttgattaagttgtttatccagac |
140 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17775541 |
aagtgcttgattaagttgtttatccagac |
17775569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University