View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16974_high_21 (Length: 410)
Name: NF16974_high_21
Description: NF16974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16974_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 119 - 364
Target Start/End: Complemental strand, 42475909 - 42475666
Alignment:
| Q |
119 |
atatcaaactttctttttctcatggtatatatgcctcatgagatgcccttgatcttatggcggcttagaagataaattcttaaacatcaatagtcttaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42475909 |
atatcaaactttctttttctcatggtatat--gcctcatgagatgcccttgatcttattgcggcttagaagataaattctaaaacatcaatagtcttaaa |
42475812 |
T |
|
| Q |
219 |
ttttcccatttctcatttactctcaactctatctctagaagctcttcgagcataaaggctaactcgtttgatggtcagaatataaaatacaatatataat |
318 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||| |||||||| ||| ||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
42475811 |
ttttcccatttctcatttactctcaattctatctctagaagctgttctagcataaacgcttactcgtttgatcgtcagaatataagatacaatatataat |
42475712 |
T |
|
| Q |
319 |
taagttattatatcatgtctcaatctaatattgcattgctcggtta |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42475711 |
taagttattatatcatgtctcaatctaatattgcattgctcggtta |
42475666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 16 - 106
Target Start/End: Complemental strand, 42477036 - 42476945
Alignment:
| Q |
16 |
tctttaacagttaacagttttgttccttaactgt--aaacnnnnnnntcactaccttttccttaacaactgatgctaacctctgtcactagct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42477036 |
tctttaacagttaacagttttgttccttaactgtaaaaaaaaaaaaatcactagcttttccttaacaactgatgctaa-ctctgtcactagct |
42476945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University