View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16974_high_29 (Length: 351)
Name: NF16974_high_29
Description: NF16974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16974_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 166 - 320
Target Start/End: Original strand, 33112809 - 33112963
Alignment:
| Q |
166 |
ttacttgttttgtaacatgcaggtgtcatatctggggctcttttgtacatcagagatgatttcaaagctgttgataccaaagtttggcttaaggtaaatt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33112809 |
ttacttgttttgtaacatgcaggtgtcatatctggggctcttttgtacatcagagatgatttcaaagctgttgataccaaagtttggcttcaggtaaatt |
33112908 |
T |
|
| Q |
266 |
tctttcatatgatatcaatgtgtattctttatatgtgttttaatttaatttctat |
320 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33112909 |
tctttcatatgatatgaatgtgtattctttatatgtgttttaatttaatttctat |
33112963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 12 - 59
Target Start/End: Original strand, 33112650 - 33112697
Alignment:
| Q |
12 |
ttcctatgtttcaatctctcatgttatcaaccattagtctatttaaca |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33112650 |
ttcctatgtttcaatctctcatgttatcaaccattagtctatttaaca |
33112697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 183 - 241
Target Start/End: Complemental strand, 21562557 - 21562499
Alignment:
| Q |
183 |
tgcaggtgtcatatctggggctcttttgtacatcagagatgatttcaaagctgttgata |
241 |
Q |
| |
|
|||||| ||||||||||||||||||||||| || ||||||||||| || ||||| |||| |
|
|
| T |
21562557 |
tgcaggagtcatatctggggctcttttgtatataagagatgattttaaggctgtggata |
21562499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University