View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16974_high_40 (Length: 260)
Name: NF16974_high_40
Description: NF16974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16974_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 39556960 - 39556710
Alignment:
| Q |
1 |
aacttccttcttgaaggagaatggtgcatgttggtgcgttagtactacagcgctcaagtcaacatgtgtaagaggtggattgtgtgcgaaataggtaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39556960 |
aacttccttcttgaaggagaatggtgcatgttggtgcgttagtactacaacgctcaagtcaacatgtgtaagaggtggattgtgtgcgaaataggtaaag |
39556861 |
T |
 |
| Q |
101 |
ttaattatatcttgagtgtgacgctgagtcacgcttatataggcgagctaattgataattgcctcc-ttgttttgcgacgtgacaccatgagtcacgaaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39556860 |
ttaattatatcttgagtgtgacgctgagtcacgcttatataggcgagctagttgataattgcctcctttgttttgcgacgtgacaccatgagtcacgaaa |
39556761 |
T |
 |
| Q |
200 |
gccgttagagatggctttgacgacaatttgatatgggtgtgttcctctgtg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39556760 |
gccgttagagatggctttgacgacaatttgatatgggtgtgttcctgtgtg |
39556710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University