View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16974_high_55 (Length: 202)
Name: NF16974_high_55
Description: NF16974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16974_high_55 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 36651252 - 36651069
Alignment:
| Q |
1 |
tatctaatggttatgagttatagcttggcggttgtgtctaatgtggtggagtgtggatccaatgataacacttgtgtgaaggttaaatacaagaactttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36651252 |
tatctaatggttatgagttatagcttggcagttgcgtctaatgtggtggagtgtggatgcaatgatatcacttgtgtgaaggttaaatacaagaactttg |
36651153 |
T |
|
| Q |
101 |
ttgataaggtggactacttgatgaagaatagcattgttgttgattcttgtcactttaccaatgaggagatgtgggtgttggttg |
184 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36651152 |
gtgataaggtggactacttgatgaagaataacattgttgttgattcttgtcacttcaccaatgaggagatgtgggtgttggttg |
36651069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University