View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16974_low_36 (Length: 317)
Name: NF16974_low_36
Description: NF16974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16974_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 19 - 307
Target Start/End: Original strand, 45089791 - 45090099
Alignment:
| Q |
19 |
ccaacatggctaaggaacctcattgcacatgatatcgacggagaagaaagacctgatccagttgacatggctactatggaaggta--------------- |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45089791 |
ccaacatggctaaggaacctcattgcacatgatatcgacggagaagaaagacctgatccagttgacatagctactatggaaggtagtgtagtgtagtgga |
45089890 |
T |
 |
| Q |
104 |
-----tggttttgtaataattttatatgatcaacttgttctaaaatgatgaatattttgtttactagtttatagagatagagaaaggggagtagcgagat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45089891 |
gtacatggttttgtaataattttatatgatcaacttgttataaaatgatgaatattttgtttactagtttatagagatagagaaaggggagtagcgagat |
45089990 |
T |
 |
| Q |
199 |
ataatgaattcagaagaaacatgctaatgatcccaattagtaagtgggaagatttaacagatgatgaagaggttattgaagctctcaaagaggtatatga |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45089991 |
ataatgaattcagaagaaacatgctaatgatcccaattagtaagtgggaagatttaacagatgatgaagaggttaatgaagctctcaaagaggtatatga |
45090090 |
T |
 |
| Q |
299 |
tgatgatgt |
307 |
Q |
| |
|
||||||||| |
|
|
| T |
45090091 |
tgatgatgt |
45090099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University