View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16974_low_40 (Length: 295)
Name: NF16974_low_40
Description: NF16974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16974_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 54075463 - 54075689
Alignment:
| Q |
19 |
gtggcgaagtttttgagggaatgggttgtgtatcattcaaaagtgggagtggaaaatttcatattgtatgataatggaagcgatgatgatgatgatttgg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
54075463 |
gtggcgaagtttttgagggaatgggttgtgtatcattcaaaagtgggagtggaaaatttcatattgtatgataatggaagcgatg---atgatgatttgg |
54075559 |
T |
 |
| Q |
119 |
agagaataattaaggagctttgtgaagagggttataatataagcacgttgctttggatttggcctaagactcaagaagctggattctctcacagtatttt |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54075560 |
agagaataattaaggagcttcgtgaagagggttataatataagcacgttgctttggatttggcctaagactcaagaagctggattctcacacagtatttt |
54075659 |
T |
 |
| Q |
219 |
gtactcaaaatccaaaggattatgcacttg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
54075660 |
gtactcaaaatccaaaggattatgcacttg |
54075689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University