View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16974_low_49 (Length: 247)
Name: NF16974_low_49
Description: NF16974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16974_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 32554089 - 32553852
Alignment:
| Q |
1 |
actgcgaaaacccatcaacagatgaacatgctgtaagttgaacatgatgaggctgcacagaagagaaatcaaattgttctacttgctgtgatgatgtgac |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32554089 |
actgcgaaaacccatcaacggatgaacatgcggtaagttgaacatgatgaggctgtacagaagagaaatcaaattgctctacttgctgtgatgatgtgac |
32553990 |
T |
 |
| Q |
101 |
tggaaggaatgaaggaacattgaaagatggtgatagtgagaaatctattgaggcagaaatgtcattgtcaatttcttcttgtgaatcaaagataactgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32553989 |
tggaaggaatgaaggaacattgaaagatggtgatagtgagaaatctattgaggcagaaatgtcattgtcaatttcttcttgtgaatcaaagataactgat |
32553890 |
T |
 |
| Q |
201 |
agattattgctattgttggaattattgttgttgatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32553889 |
agattattgctattgttggaattattgttgttgatatt |
32553852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 123 - 194
Target Start/End: Complemental strand, 16921324 - 16921253
Alignment:
| Q |
123 |
aaagatggtgatagtgagaaatctattgaggcagaaatgtcattgtcaatttcttcttgtgaatcaaagata |
194 |
Q |
| |
|
|||||| ||||| || ||||||||| || || |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16921324 |
aaagattgtgatgatgtgaaatctatagaagctgaaatgtcattgtcaagatcttcttgtgaatcaaagata |
16921253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University