View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16974_low_51 (Length: 244)
Name: NF16974_low_51
Description: NF16974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16974_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 13 - 130
Target Start/End: Original strand, 192375 - 192493
Alignment:
| Q |
13 |
aatattgaacaaaactcgatataaatttcaaaa-aatagaaacctagatatttctcattttcacaattttggttgtgattgttgcattttagactacaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
192375 |
aatattgaacaaaactcgatataaatttaaaaaaaatagaaacctagatatttctcattttcacaattttggttgtgattgttgcattttagacgacaaa |
192474 |
T |
 |
| Q |
112 |
taaagcatgcatgtcattt |
130 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
192475 |
taaagcatgcatgtcattt |
192493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University