View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16974_low_52 (Length: 238)
Name: NF16974_low_52
Description: NF16974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16974_low_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 20 - 223
Target Start/End: Complemental strand, 44364816 - 44364613
Alignment:
| Q |
20 |
atagtcctctctgccaatccaagaggtgaacgagattgaagacgcttcacatctttgagtctcctcatatataactctgcctccaatgatggttgtttga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44364816 |
atagtcctctctgccaatccaagaggtgaacgagattgaagacgcttcacatctttgagtctcctcatatataactctgcctccaatgatggttgtttga |
44364717 |
T |
 |
| Q |
120 |
ttttctcgatttcttccttgattttgatcacttggctatgaacagcaagacctgcatacacctcctcatcactcttgttgttgttgctcttgaattccat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44364716 |
ttttctcgatttcttccttgattttgatcacttggctatgaacagcaagacctgcatacacctcctcatcactcttgttgttgttgctcttgaattccat |
44364617 |
T |
 |
| Q |
220 |
cttc |
223 |
Q |
| |
|
|||| |
|
|
| T |
44364616 |
cttc |
44364613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University