View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16974_low_56 (Length: 228)
Name: NF16974_low_56
Description: NF16974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16974_low_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 1885695 - 1885478
Alignment:
| Q |
1 |
attaccatcaattccgtgctgatgagaatttacatccttttccatgatgctcctgtatgcgctacgaacggaatagatactgtttttctcaagtttccac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1885695 |
attaccatcaattccgtgctgatgagaatttacatccttttccatgatgctcctgtatgcgctacgaacggaatagatactgtttttctcaagtttccac |
1885596 |
T |
|
| Q |
101 |
acacatctatcttgctgcgcggtagaaatcagaggtgttctgcgaatttgataagctgaaatgttgtcaaataaataatattctccatctgccattgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1885595 |
acacatctatcttgctgcgcggtagaaatcagaggtgttctgcgaatttgataagctgaaatgttgtcaaataaataatattctccatctgccattgttt |
1885496 |
T |
|
| Q |
201 |
ggtgtatcctttgcttct |
218 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
1885495 |
ggtgtatcctttgtttct |
1885478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University