View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16974_low_61 (Length: 223)
Name: NF16974_low_61
Description: NF16974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16974_low_61 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 49 - 207
Target Start/End: Complemental strand, 34063804 - 34063646
Alignment:
| Q |
49 |
atgtctgttcttcttccaacaacttcaaaacctcttttttcaattcgacccaacaacgtacatatgaacaagttgaagatgaaaacaaaccggtttactg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34063804 |
atgtctgttcttcttccaacaacttcaaaacctcttttttcaattcgacccaacaacgtacatatgaacaagttgaagatgaaaacaaaccggtttactg |
34063705 |
T |
|
| Q |
149 |
tttctgctgttgttgctgaagatgctgctgctgtttccctccaacctccacctcaatct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34063704 |
tttctgctgttgttgctgaagatgctgctgctgtttccctccaacctccacctcaatct |
34063646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University