View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16974_low_64 (Length: 214)
Name: NF16974_low_64
Description: NF16974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16974_low_64 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 115 - 178
Target Start/End: Original strand, 44364528 - 44364592
Alignment:
| Q |
115 |
acatggtatccttgaatagg-ttataccaagacaaacaaatctgactagattttcagtattgttt |
178 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44364528 |
acatggtatccttgaataaccttataccaagacaaacaaatctgactagattttcagtattgttt |
44364592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University