View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_high_14 (Length: 417)
Name: NF16975_high_14
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 398; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 1 - 398
Target Start/End: Complemental strand, 43538705 - 43538308
Alignment:
| Q |
1 |
attaatactccaagatatcaaccacctatttcgaaattgattttctatactcgttatatcatgctggcctttaattagtcagtatcttgatttgtgataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43538705 |
attaatactccaagatatcaaccacctatttcgaaattgattttctatactcgttatatcatgctggcctttaattagtcagtatcttgatttgtgataa |
43538606 |
T |
|
| Q |
101 |
agatagtaacctaccagtaaaatctggccaggcattgacattaatggaagaatttgggatcaagccagatgtagtgacgtatagcaccatcatgaatgcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43538605 |
agatagtaacctaccagtaaaatctggccaggcattgacattaatggaagaatttgggatcaagccagatgtagtgacgtatagcaccatcatgaatgcg |
43538506 |
T |
|
| Q |
201 |
tggagttcatcggggcttatggacaattgtgaggagatatttgatgacatggtgaaggctgagatagaaccggacatccaagcttatagcatccttgcaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43538505 |
tggagttcatcggggcttatggacaattgtgaggagatatttgatgacatggtgaaggctgagatagaaccggacatccaagcttatagcatccttgcaa |
43538406 |
T |
|
| Q |
301 |
aaggctatgtacgtgcagggcagccagataaagctgaggctcttctgaattcgatgaccaaatacggtttacaagcaaatgttgtgatcttcactacc |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43538405 |
aaggctatgtacgtgcagggcagccagataaagctgaggctcttctgaattcgatgaccaaatacggtttacaagcaaatgttgtgatcttcactacc |
43538308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University