View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_high_27 (Length: 347)
Name: NF16975_high_27
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 20 - 331
Target Start/End: Complemental strand, 1171226 - 1170915
Alignment:
| Q |
20 |
gaagaacacccagaagaaaaagtatggttttttctcccttacggaaattgatgcagcaaaactcctaatagaacttagtaatagcacaacctacttggat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1171226 |
gaagaacacccagaagaaaaagtatggttttttctcccttacggaaattgatgcagcaaaactcctaatagaacttagtaatagcacaacctacttggat |
1171127 |
T |
 |
| Q |
120 |
gaaaattgccatagcaatagcagcaagagcgtcacggtgcaatcgatgacacaacagagtaaggatagtgatgatatttcaccatcatcacctacagatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||| |||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1171126 |
gaaaattgccatagcaatagcagcaacagcgtcacggtgcaatcaatgacgcaacggagtaaggatagtgatgatatttcaccatcatcacccacagatt |
1171027 |
T |
 |
| Q |
220 |
cagttgaggatgtgttggcagaaattgaagaagatgaacggttaaggaggaagaacaagaggtttcgatatgttgaagaagtgtatagagttacagatcc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1171026 |
cagttgaggatgtgttggcagaaattgaagaagatgaacggttaaggaggaagaacaagaggtttcgatatgttgaagaagtgtatagagttacagatcc |
1170927 |
T |
 |
| Q |
320 |
tatagttattgt |
331 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1170926 |
tatagttattgt |
1170915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University