View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_high_37 (Length: 291)
Name: NF16975_high_37
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 15 - 273
Target Start/End: Complemental strand, 41613108 - 41612850
Alignment:
| Q |
15 |
aaaggcaaaaagaaagcattttctgtctaaaaagaaaaggataaggtaagccttgctcttaataggaggattaattagcacaaaacatggtgtttaagga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41613108 |
aaaggcaaaaagaaagcattttctgtctaaaaagaaaaggataaggtaagccttgctcttaataggaggattaattagcacaaaacatggtgtttaagga |
41613009 |
T |
|
| Q |
115 |
taattttagtacctgaccaaaccaagaatatatgattggattatcttgagagagatcctaggaatcaaatatttccctaaaatctatgataatggattca |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41613008 |
taattttagtacctaaccaaaccaagaatatatgattggattatcttgagagagatcctaggaatcaaatatttccctaaaatctatgataatggattca |
41612909 |
T |
|
| Q |
215 |
cccccaaaaattctctaaaattagtctcttgtattcttcaacatttgcagggatgcatg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41612908 |
cccccaaaaattctctaaaattagtctcttgtattcttcaacatttgcagggatgcatg |
41612850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University