View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_high_40 (Length: 253)
Name: NF16975_high_40
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_high_40 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 12 - 253
Target Start/End: Original strand, 8624237 - 8624478
Alignment:
| Q |
12 |
aagaatataatggaatagtttcatgctccattttttggaatggagtagatcaaaatgaaaatactgtttccctcgtgtactactgcagcacttctaactt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8624237 |
aagaatataatggaatagtttcatgctccattttttggaatggagtagatcaaaatgaaaatactgtttccctcgtgtactactgcagcacttctaactt |
8624336 |
T |
 |
| Q |
112 |
tctaaaatgtagcaaaaatcaaattgcaagtacataatttttaagcaacatctaagggatgggtaaaattgtgatgcacctttcctcgacaaacaccaag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8624337 |
tctaaaatgtagcaaaaatcaaattgcaagtacataatttttaagcaacatctaagggatgggtaaaattgtgatgcacctttcctcgacaaacaccaag |
8624436 |
T |
 |
| Q |
212 |
taaagctgctcctcctttcttagtatcctgtatggaatcaac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8624437 |
taaagctgctcctcctttcttagtatcctgtatggaatcaac |
8624478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University