View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_high_61 (Length: 230)
Name: NF16975_high_61
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_high_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 39790565 - 39790768
Alignment:
| Q |
1 |
tctccgcatgaaaatatctttgactaatttggctatcattagtagtttttcgatgaataaattggactgtaataaaaattgtgacaggcaaaattgagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39790565 |
tctccgcatgaaaatatctttgactaatttggctatcattagtagtttttcgatgaataaattggaccgtaataaaaattgtgacaggcaaaattgagtt |
39790664 |
T |
 |
| Q |
101 |
ttta---taaaaataaatttgttattaattgatagtaacatagtattatgaagcactgtcatgcatgcagctgcaaatctcacatgtccggtttttaatt |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39790665 |
tttagtctaaaaataaatttgttattaattgatagtaacatagtattatgaagcactgtcatgcatgcagctgcaaatctcacatgtccggtttttaatt |
39790764 |
T |
 |
| Q |
198 |
atta |
201 |
Q |
| |
|
|||| |
|
|
| T |
39790765 |
atta |
39790768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University