View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_high_67 (Length: 221)
Name: NF16975_high_67
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_high_67 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 19 - 172
Target Start/End: Original strand, 3658528 - 3658680
Alignment:
| Q |
19 |
accatttttatcacatcagcttctacaaacggtttctcaaatgggagggcctcaaagaataaaatgttttttcttttgccttctttataatgatggtttg |
118 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3658528 |
accatttttatcacatcaccttctaagaacggtttttcaaatgggagggcctcaaagaataaaatgttttttcttt-gccttctttataatgatggtttg |
3658626 |
T |
|
| Q |
119 |
aagactaatgaaaaaagatctagatgtggtatggatactagtttatgtcctttg |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3658627 |
aagactaatgaaaaaagatctagatgtggtatggatgctagtttatgtcctttg |
3658680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 205
Target Start/End: Original strand, 3658675 - 3658703
Alignment:
| Q |
177 |
cctttgataagtaaaccgcccttcatatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3658675 |
cctttgataagtaaaccgcccttcatatt |
3658703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University