View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_high_70 (Length: 211)
Name: NF16975_high_70
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_high_70 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 14 - 195
Target Start/End: Original strand, 40006227 - 40006407
Alignment:
| Q |
14 |
ataatactgtttttcactttaaaaagtgatgtctaaactgataacagtgtacgaatagcgcttnnnnnnnnntatttaaggccnnnnnnntgtgttatct |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||||| |
|
|
| T |
40006227 |
ataacactgtttttcactttaaaaagtgatgtctaaactgataacagtgtaggaatagcgcttaaaaaaaa-tatttaaggccaaaaaaatgtgttatct |
40006325 |
T |
|
| Q |
114 |
aaggtcatttttggcgtagtgagggaaatgaagattagattggttaagtggtttgggagagagatgtgaggacagtcaactt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40006326 |
aaggtcatttttggcgtagtgagggaaatgaagattagattggttaagtggtttgggagagagatgtgaggacagtcaactt |
40006407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University