View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_high_73 (Length: 203)
Name: NF16975_high_73
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_high_73 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 36947783 - 36947975
Alignment:
| Q |
1 |
tctctatgcatgctgctaaagtatgtgtctcaggtccttcatcagtcaaagtggatcgatgactctccggctgaaattaagcatgttagatgactcacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36947783 |
tctctatgcatgctgctaaagtatgtgtctcaggtccttcatcagtcaaagtggatcgatgactctccggctgaaattaagcatgttagatgactcacat |
36947882 |
T |
|
| Q |
101 |
aatttacaaaaccatgcatgtgcttaaaagatagaaaaccaatcattggtgttaatagagattagcttggcaataattgtatatctgtgctgc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
36947883 |
aatttacaaaaccatgcatgtgcttaaaagatagaaaaccaatcattggtgttaatagagattagcttggcaataattgtatatatgggctgc |
36947975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University