View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_low_17 (Length: 394)
Name: NF16975_low_17
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_low_17 |
 |  |
|
| [»] scaffold0197 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0197 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 11 - 379
Target Start/End: Original strand, 10937 - 11316
Alignment:
| Q |
11 |
cacagaacattgaaccaatcaaaaagttaactaactatccatgaatgtagtttgggatagtctttattgatgtcatggccctcttaagtaggttgcttgg |
110 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10937 |
cacagaacattgaaccaatcaaaaagtgaactaactatccatgaatgtagtttgggatagtctttattgatgccatggccctcttaagtaggttgcttgg |
11036 |
T |
 |
| Q |
111 |
gtgtataagtttttgcggtccatggatgcatagatttcaagataaagacaaatagaaggacttgttaaaatcaaactggtccttgaaccttgnnnnnnng |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11037 |
gtgtataagtttttgcggtccatggatgcatagatttcaagataaagacaaatagaaggacttgttaaaatcaaactggtccttgaaccttgtttttttg |
11136 |
T |
 |
| Q |
211 |
ttgttgttgctatg-----------atattgctttcattattattgtgagtttgggacctatcttcgattcttaccatctgatgatgcacatggttgtac |
299 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11137 |
ttgttgttgctatgatattgattatatattgctttcattattattgtgagtttgggacctatcttcgattcttaccatctgatgatgcacatggttgtac |
11236 |
T |
 |
| Q |
300 |
ttctattttcagcataatggttgtacttctatttttagcataagcactaaaatgagaattgagaggaccatggataaaat |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11237 |
ttctattttcagcataatggttgtacttctatttttagcataagcactaaaatgagaattgagaggaccatggagaaaat |
11316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University