View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_low_24 (Length: 357)
Name: NF16975_low_24
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 20 - 127
Target Start/End: Complemental strand, 2095581 - 2095474
Alignment:
| Q |
20 |
taactagaagaatatgaagaacaaagaaaggttggtggaagagtggctagaagaagtttaaatcctgtcttgaaagaagttaaaaagcaaggtgtccggc |
119 |
Q |
| |
|
||||||||||| | | |||||||||||| ||||||||||||||||||||||||||||| | |||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
2095581 |
taactagaagatttttaagaacaaagaagggttggtggaagagtggctagaagaagttcatgtcctgtcttggaagaggttaaaaagcaaggtgtccggc |
2095482 |
T |
 |
| Q |
120 |
tacgactt |
127 |
Q |
| |
|
| |||||| |
|
|
| T |
2095481 |
ttcgactt |
2095474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 256 - 344
Target Start/End: Complemental strand, 2095309 - 2095221
Alignment:
| Q |
256 |
tggtttccttttgatgatattatggatttttcgtgccttggggaacaaattgcataatattatcaaattttaggtctaactgtttaagc |
344 |
Q |
| |
|
||||||| ||||| ||| ||||||||| || || ||||||||||||||||||||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
2095309 |
tggtttctttttgttgaatttatggattattgatgacttggggaacaaattgcataatattatcagatttgaggtctaattgtttaagc |
2095221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University