View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_low_35 (Length: 313)
Name: NF16975_low_35
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 15218736 - 15218892
Alignment:
| Q |
1 |
ttatggtggcatagaactgagttcacctactcttgcatctgcaatgcttaacctcattccagctttcacttttgtacttgcactgattttcaggttcctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15218736 |
ttatggtggcatagaactgagttcacctactcttgcatctgcaatgcttaacctcattccagctttcacttttgtacttgcactgattttcaggttcctc |
15218835 |
T |
 |
| Q |
101 |
atatgattattaaactttactaaaaggtgaattttatggaaaatatatttctaacac |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15218836 |
atatgattattaaactttactaaaaggtgaattttatggaaaatatatttctaacac |
15218892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 220
Target Start/End: Original strand, 15218916 - 15218956
Alignment:
| Q |
180 |
attagatgaaattcatatggatcccacattttgaaaatgga |
220 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
15218916 |
attagataaaactcatatggatcccacattttgaaaatgga |
15218956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University