View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_low_41 (Length: 268)
Name: NF16975_low_41
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_low_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 19 - 138
Target Start/End: Complemental strand, 44003844 - 44003725
Alignment:
| Q |
19 |
ctaccttgcaatttgtgttgaaaataccaatttatacatcagtgacaaacatgtgtcatgtgtccttatttggatcggtgacacaacttctcaaagataa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44003844 |
ctaccttgcaatttgtgttgaaaataccgatttatacataagtgacaaacatatgtcatgtgtccttatttggatcggtgacacaacttctcaaagataa |
44003745 |
T |
 |
| Q |
119 |
taattaacatgcaattggtt |
138 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44003744 |
taattaacatgcaattggtt |
44003725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 156 - 255
Target Start/End: Complemental strand, 44003738 - 44003640
Alignment:
| Q |
156 |
acatgcaattggttgaatgtttataatgcggatccattatcannnnnnncaatttcgtacctcttcaagctaagtaaaatcaaggtgcttactcatgtct |
255 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
44003738 |
acatgcaattggttgaatgtttatcatgcggatccattat-atttttttcaatttcgtacctcttgaggctaagtaaaatcaaggtgcttactcatgtct |
44003640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University