View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_low_45 (Length: 250)
Name: NF16975_low_45
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 16873800 - 16874044
Alignment:
| Q |
1 |
ttcaaagactatgtatgcactaaggataactagaatataattaagagttgttagagaagttattt----gattagtttgttaggagattgctaggttctg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| ||||| || ||||||||||||||| ||||| ||||||||| |
|
|
| T |
16873800 |
ttcaaagactatgtatgcactaaggataattagaatataattaagagtttttagaggagttacttagttgattagtttgttaggtgattgataggttctg |
16873899 |
T |
 |
| Q |
97 |
ttgttattttgtttattctcgacaagtatttgaataacgcttgaggggaggggataattttgattaaacgcgttttgtgactgattaatacatattttgc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16873900 |
ttgttattttgtttattctcgacaagtatttgaataacgcttgaggggaggggataattttgattaaacgagttttgtgactgattaatacatattttgc |
16873999 |
T |
 |
| Q |
197 |
gatcttgattaatacatattttctgttttctttcccttttcatct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16874000 |
gatcttgattaatacatattttctgttttctttcccttttcatct |
16874044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University