View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_low_51 (Length: 245)
Name: NF16975_low_51
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 41613085 - 41613309
Alignment:
| Q |
1 |
agaaaatgctttctttttgccttttataatgaacggtgggtaatattttaaggaatttgagagtgaaaaaacataccgtacttatgtagaacactacaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41613085 |
agaaaatgctttctttttgccttttataatgaacggtgggtaatattttaaggaatttgagagtgaaaaaacataccgtacttatgtagaacactacaag |
41613184 |
T |
 |
| Q |
101 |
tactagacatgttctaataaaaaataagagaaatcaaatctaggtttaactgcttattcactccacattctttaactatcttaactcttaacttcatcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41613185 |
tactagacatgttctaataaaaaataagagaaatcaaatctaggtttaactgcttattcactccacattctttaacta-------ccttaacttcatcca |
41613277 |
T |
 |
| Q |
201 |
tgtgagatgtatatacattggtaatatgttga |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41613278 |
tgtgagatgtatatacattggtaatatgttga |
41613309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University