View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_low_60 (Length: 236)
Name: NF16975_low_60
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_low_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 32861584 - 32861787
Alignment:
| Q |
1 |
tattgatcatatgttgaaaaacaaagctgtgcatggtaccatggttttaaattgtggttgcgtatgcggttgcggttgcggacacaacgattgtggacat |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32861584 |
tattgatcatatgttgaaaaacaaacttgtgcatggtaccatggttttaaattgtggtcgcgtatgcg------gttgcggacacaacgattgtggacat |
32861677 |
T |
 |
| Q |
101 |
tgcagttgttgcgatgcttattgcagtcattgcagcgtggacacgacactgatattgacatattgactggtaaaaatttaagaaaatgaacgtaatcaca |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32861678 |
tgcagttgttgcaatgcttattgcagtcgttgcagcgtggacacgac-ctg--------atattgagtggtaaaaatttaagaaaatgaacgtaatcaca |
32861768 |
T |
 |
| Q |
201 |
tgtgttgttgtcggatatt |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32861769 |
tgtgttgttgtcggatatt |
32861787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University