View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_low_63 (Length: 233)
Name: NF16975_low_63
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_low_63 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 44003639 - 44003420
Alignment:
| Q |
1 |
atgatccggtttgcgactacctaggtgatttggaaggnnnnnnnttataggattttcagaggccaacaaaaatcttattatcaatttttggaaagtatca |
100 |
Q |
| |
|
||||||| |||||||| | |||| ||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
44003639 |
atgatccagtttgcgagtccctaagtgatttggaaggaaagaaatgataggattttcagaggccaacaaaaatcttattatcagtttttggaaaatatca |
44003540 |
T |
|
| Q |
101 |
agcttcnnnnnnnggtggtttaaggctaagtttgctatgtttcattctaagttttatgattggcgttaacacccttttttatgctcaggtgtgctagttg |
200 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
44003539 |
agcttctttttttggtggtttaaggctaaatttgctatgtttcattctaagttttatgattggcgttaaca-ccttttttatgctca--tgtgctagttg |
44003443 |
T |
|
| Q |
201 |
ttattattgttgttgaacctatg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44003442 |
ttattattgttgttgaacctatg |
44003420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 114 - 185
Target Start/End: Complemental strand, 40516216 - 40516146
Alignment:
| Q |
114 |
ggtggtttaaggctaagtttgctatgtttcattctaagttttatgattggcgttaacacccttttttatgct |
185 |
Q |
| |
|
||||||| ||||||||||||||| | ||| ||| ||||||| |||||||| | |||||||||||||||||| |
|
|
| T |
40516216 |
ggtggttcaaggctaagtttgctgttttttattataagtttaatgattggtg-caacacccttttttatgct |
40516146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University