View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_low_69 (Length: 226)
Name: NF16975_low_69
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_low_69 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 2 - 143
Target Start/End: Original strand, 38316471 - 38316617
Alignment:
| Q |
2 |
gattcaccggatagttagttagtttgtcttttaaaatgaaagactat-----tgtttggccaagcnnnnnnnaggatttataggttatttggaagccaaa |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | ||||||||||| |||||| |||||||| |
|
|
| T |
38316471 |
gattcaccggatagttagttagtttgtcttttaaaatgaaagactatagctatgtttggccaaactttttttaggatttatagactatttgaaagccaaa |
38316570 |
T |
 |
| Q |
97 |
actaacaataagtgctttaaggtaaagttaaaattgtttggtaatta |
143 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38316571 |
gctaacaataagtgctttaaggtacagttaaaattgtttggtaatta |
38316617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 84 - 142
Target Start/End: Original strand, 10490409 - 10490469
Alignment:
| Q |
84 |
tttggaagccaaaactaacaataagtgcttta-aggtaaagttaaaa-ttgtttggtaatt |
142 |
Q |
| |
|
||||||||||||| |||||||||||||||||| | | |||| ||||| ||||||||||||| |
|
|
| T |
10490409 |
tttggaagccaaagctaacaataagtgctttagaagcaaagctaaaagttgtttggtaatt |
10490469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University